UFO Dives Into Mexico Volcano Caught on 24/7 Webcam

I kid you not, this is a UFO that if there was no evidence of it you'd probably think that the story is a bit far fetched.



But, it also divides a lot of people because to some it's a bit to far fetched but to so many people, "we" believe that anything is possible especially real UFOs vouched for by the Government.

Check out this amazing image taken from the webcam which monitors volcano...




Image credit webcamsdemexico.com



It's filmed in Mexico in 2012 and it's not the first one to do a direct dive into a volcano as Google has a ton of volcano slash UFO videos that show some strange goings on.


















Some have concluded that the object is either a computer-generated hoax, or a simple glitch in the video. Dr. Margarita Rosado Solis suspects the visible object in the video she was shown was not in the original video... But, that doesn't make any sense at all to me because "why would she be shown a random video without a UFO".



Here's the YouTube popocatepetl UFO video by Weird World TV.














The whole reason why she was shown it was to comment on the anomaly. See, it's a 24/7 recording so why would the fine Dr be shown a specific part of a video. What was her original reason for looking at the volcano footage? See the full story here.



Volcanoes are a raw energy system that travels right into the Earth, is this why they are attracted to the volcano do you think?

Check out this quote from Mexico News Daily;

One area with many sightings is the San Mateo corridor, where planes coming in from the north approach the international airport.

Sightings here usually describe a light or spherical object that moves off to the side as a plane approaches and returns after it has passed.









In a new video, a UFO seems to approach Mexico's Popocatepetl volcano, then slows down, turns and deliberately enters the smoldering volcano crater.

The video, recorded on May 30 at around 8:30 p.m (the below video), is the latest in a series of alleged UFO events that have taken place near the central Mexico active volcano since late 2012 (the above video).















According to International Business Times, Televisa caught the alleged UFO image on a fixed camera that is used to monitor the volcano's daily activity, located about 40 miles south of Mexico City.








I've actually written a few news articles and blog posts about this very subject which is quite real as far as I can tell. I'll add the link to at least one of the posts for you.


This Bizarre Letter C Was Found on a Moon Rock

Was NASA was uilising amazing model makers back in the 1930's even, and the 60's?



Like prop developers, model designers and set designers plus hobbyist's, including but not limited to architectural "scale model masterpieces" could of been created, "no problem".



Exact replicas of the Moon can and have, been created in the past - that's for sure and it is done with ease. The history and purpose of these exact replica Lunar spheres is one thing i.e reference guides and astronomy, education and for TV shows etc. But conspiracy theorists keep on coming up with one interesting idea after another that is challenging NASA to prove that they went to the Moon.




Letter-C-on-a-Moon-rock-in-NASA-image


Image NASA


Let's take just one example, the C rock. I found a website that just states "if you get your facts right, it was added after the recording of the Moon landing" - and that's it? Link is at he bottom.

This is the evidence that we're supposed to believe, someone says it was added and take their word for it? Although i'm sure that this is because he or she knows something else, it would be great to show it is that makes sense? Like a before and after maybe?


But then you have this amazing and talented man (below image) with mad skills to create a to scale replica of the Moon and then it just becomes apparent that it could of been faked with ease and I mean "with ease".



Illustrator-and-model-maker-Roger-Hayward-(1899-1979)-working-on-a-model-of-the-lunar-surface-for-the-Griffith-Planetarium-1934



Image of Roger Hayward Griffith Planetarium 1934.



Millions of photo's were taken on the Moon, millions of photos and video was taken and just because someone says it's not in the official images or video, that doesn't fill me with confidence at all.

By the way, all the Apollo missions photos and videos are missing! Only a bit has survived at all. Like a whole room full of media is missing!

In fact, it kinda tells me that it's just saying the official statement by the vested powers that be whom want to continue the charade and status quo? Astronauts in modern times get upset when people say it was faked because it's casting doubts on their fellow astronaut brothers.

But...

Look at why people cast doubts on NASA - don't hate the message, hate the lies by NASA?

Look at the evidence and that way you'll see why millions of people around the world say that NASA lies. My voice is but one, in a VAST ocean of voices.

But, each to their own and the fact is that millions of people have doubts and these doubts are based in NASA irregularities. So what, I mean "so what" if someone doesn't agree with your opinion or current knowledge? That's a good thing, it spurs me on to get answers one way or another.

The Moon, with it's surface uneven and with the rocks on the Moon coming in all shapes and sizes. So the engineers, creators and NASA back then knew that they would need exact replicas of the terrain "in the specific area" they was to be landing on because the future of telescopes, space travel is coming and will get so good, they needed a convincing set and props!

It could of been replicated very easy. Especially with the close up photos of the Moon and how it looks. This information was available to anyone at NASA wishing to replicate the surface of the Moon.



Reach for the Moon and if not, get a grabber and grab the Moon with all your cunning and deviousness of props and sets just like a Stanley Kubrick movie would be set up!

But, not all is as it all seems to be - or is it!

In the Cold War there was a lot at stake and riding on the success of the Lunar Mission and if it failed (God forbid - it apparently didn't) but if it did, did the United States Government have an ace up their sleeve as it were?

Was that ace up "the proverbial sleeve" an actual movie set all ready to go and all ready to show the public an actual choreographed hoax, instead of a real life botched attempt at travelling to the Moon?

Depends on who you ask, doesn't it?


Close-up-look-at-the-letter-C-on-the-Moon-rock-from-the-Apollo-Moon-Mission's




There is a lot to focus on when writing about the Moon landing hoax. It can't be done in one blog post unless your just covering the basics instead of digging deep in to the facts and the motives plus the abilities.

The USA definitely had the abilities and the right people all on board to help the nation through a space race "they had to win" either unwittingly or knowingly they had the people for each step of every way and every process, to pull off one of the 20th centuries biggest hoaxes.

Please leave a comment.
Source NASA.
Source Data Physics.
Source Reference Miehana.
Source Reference Proofofthemoonlanding.

Diamond UFO Filmed Over Moscow From Airplane Window

The many and various airplane UFO incident's are probably one of the hardest to fake or hoax because it's easily "and I mean easily noticed".




Credit Disclosure Screen The Grimreefar YouTube.













If it's been tampered with or if it's  even had any effects applied to it, and or added in plus superimposed onto it, or even inserted into the video we can all easily detect it. Guy's, check out our Instagram page and Facebook group for excellent UFO videos and where UFO events are posted just after they have happened.


Easy detectable hoaxes are ten to the dozen I agree but I also agree that hoaxers are a canny bunch and a devious "innately dishonest bunch" of toe rags. But, there's something about this UFO video that I like. I don't believe that they've done anything with it.


t's an easy going, easy flowing UFO video without any juddering, shaking, blips, clips and transitions overlapping of the colors in the shapes.




The UFO is going just behind the planes engine


Credit: Disclose Screen The Grimreefar YouTube.



Because I'm confident about this being real, I'm going to look into this even further to get us more information because it is awesome. This is just a blog news article to point out to you that this is possibly real and very good (might I add) UFO video so people are going to be at least up to speed with this latest UFO video. This is part of what I love to do, it's about bringing you great UFOs seen by real eye witnesses and then delivered straight to your dinner table (so-to-speak).














Without further ado, here's the video which was uploaded to YouTube by Disclose Screen The Grimreefar:








Here's another awesome UFO video which in this case is a Flying Saucer video from over Russia.


Credit: Disclose Screen The Grimreefar YouTube.

Von Braun Prophecy About Elon on Page 391 In His Own Papers

This is crazy, like major bizarre and strange combined with all the trimmings of a yellow submarine! But very satisfying and compelling.



I honestly don't know what to make of the so-called fictitious book wrote by Wernher Von Braun in the late 1940's? I say that because it almost seems like it's a tale but of reality, or as damn close to it that anyone without prior knowledge of, could ever write.















Was there an ancient but advanced civilization on Mars in the very distant past and did surviving Martians come here to Earth to seek refuge and did they pay the gate keeper (so to speak) with secret knowledge? The wonders of the ancient past would definitely fit in with this theory. So, we have to narrow it down even more, link things that could only be from an advanced civilization with links to Mars i.e this is why people are linking Pyramids on Mars with the ones here on Earth!


Is it all just one big coincidence? But remember, there's so many coincidences, lot's and lot's which in my eyes nullifies that theory.


Is Mars nothing more than a rock in space without any life ever existing there, or is Mars the stepping stone, the propagator, the place where it all began from and where all advanced knowledge spawned from? It was definitely important to Von Braun and it's extremely important to Elon whom is the name of the guy Von Braun wrote about saying that he (Elon) will take mankind to Mars in reusable rockets!


Mind blower or what.


So, I wanted solid evidence of this. I wanted to know if this is real or are the people who say it's fake or it's not true - are they correct?


Related post



OMG, it turns out that as hard as it is to believe, Von Braun was a prophet and he didn't even know it! It's all true.



Mars civilization destroyed by whatever means necessary.


Mars concept, Google Search.


So, here's the story and what a story it is.

















Wernher Von Braun wrote a book and in this book he says that a man called Elon will take mankind to Mars and while using reusable rockets, he will then become the head 
Was Von Braun in communication with Aliens or was he deciphering a signal from humans in the future sent back using speed? Apparently going so fast, things go backwards.




Alien contact or signal from the future from humans.



Alien contact and signal from the future from humans, Google search.


It's beyond coincidental because it talks of a man taking humans to Mars, a man named specifically as Elon, but also in rockets that are reusable! If that right there isn't a prime candidate for hidden, secret knowledge from the matrix then I really do not know what is?


I'm been serious here, is this time travel (not physical time travel but sending signals through time and space, dimension, energy if you like). Or is it a matter of decoding our human DNA where everything is stored and discovering a repeated mathematic equation which is the template for everything. A code for example.


One code but to get different messages, you apply a different way of decoding different codes,?


Code:


ATAAGTTAAGAGTAGTTAGTTTAG


Can we determine the evolutionary process through different methods and can we determine where we're going i.e specifically just like Wernher actually did? Is everything that will be or ever be, just a case of deciphering DNA with mathematics and has it been achieved in the future? If not, answer me this: How was he able to be very, extremely accurately in his "fictitious book" call the call Elon which is not a common name at all? There's no way on this Earth that all the accurate things said was one coincidence after another! No way on this God's Green Earth! Wernher wasn't a prophet so this must of come by other means and that, therein, lies the mystery...



Where did he get this information? Don't forget this was late 1940's so why did Von Braun get an unlimited free reign from the Nazis and then subsequently from United States? What did he know, what was he able to say because that's all he had was his words and then be able to get off scott free from one of mankinds worst atrocities which he utilized as forced labourers and he never ever, not once said sorry for!




Is it tapping into the realms of innate abilities (is that what he could do) or is it Alien interaction where they gave him (Von Braun) visions and secret knowledge to convince people with or quite literally could he see into the future and have shared the knowledge with the Nazis and then the US Government. It was a race to round up the scientists after the second world war.





Let's be honest, it was a race to Get Von Braun "only" and here's why I know that, please, if you will - can you name me the other people that the US and the UK plus Russia was trying to round up? EXACTLY!



Or was it just because he was the most technically savvy human being at that time regarding rockets and what it will take to deliver a rocket into any country was all knowledge but stored in his head?


If he gave them it on paper, they could get rid of him and his "horrific beginnings" and attribute the knowledge to someone else? So, keeping all the knowledge in his head would safe guard him and his chosen few?


Now that, while not verified or even contemplated by many isn't a fact, it definitely fits the answer perfectly as if it where a glove made for his grubby little fingers! I say grubby little hands because I do believe he has blood on his hands and for not apologizing (the least he could do) he is forever open to the harshness of peoples opinions throughout the forever time. It's the least we can do.


If Aliens know the future, that they've somehow cracked the code that is the future - it stands to reason they know the past so they would know whom to talk to, whom to implant knowledge, whom to bestow or depart the sacred knowledge to and yes, it is sacred knowledge.


It's knowledge of the future, it's knowledge only available to a God or God like entity so it must be sacred but only if you subscribe to this notion! If not then it's just a code to crack by anyone and it's open to anyone because it's a race. A race of knowledge and "the truth will set you free" but from what? This burden of reality, all the pitfalls and the worries, the strain, grief and pain of seeing your loved ones die.


Maybe, who knows, right?


If you think it sounds crazy, I agree lol. but, just read what Von Braun wrote, he wrote about Elon, about taking mankind to Mars (not Pluto, not Venus or Uranus but Mars). So, please before you start to resort to your default setting of sarcasm, dismissal, rejection and to poke fun at the crazy person writing bizarre and crazy things. Just remember what he wrote and accurately I might add and what he prophesized! Please.



  Results of what I have discovered might be way off but then again it's 50/50 because it's either correct or incorrect...



Artist's impression of SpaceX's proposed Mars Base Alpha. Credit: SpaceX.

There's just no way that Von Braun knew Elon... He died in 1977! Elon was a kid at the age of 6yrs! Von Braun wrote this book in 1948.



Von Braun.



Von Brauns book Project Mars


So, wtf is going on? If your wondering why Von Braun and Elon are been talked about here - it's because Von Braun prophesized that a man called Elon would take mankind to Mars and will become the Head of the colony on Mars!




This is from Von Braun'sown book which I have found, and found the original script for the book. People said this is a myth and that Elon is not even mentioned in this book but I'm here to set that record damn straight with a link to the prophecy book that is "Project Mars A Technical tale". The book first published in 1950 and subsequently in 2006, 20th October.

Check this snippet from an article I read (all links are at the bottom of the page also).


Before German-turned-American engineer Wernher von Braun was conscripted to build rockets for the Apollo project, he published a short book in German, "Das Marsprojeckt" (later translated to English). It envisioned reusable rockets!


Does it sound familiar to you? 

Reusable rockets, it's possible that we are witnessing nothing more than a coincidence? But then it gets more Simpsons than Simpsons could ever get! It gets to specific for my liking, and I do not believe in coincidences - at all, forever, full stop. No such thing.



Aliens are watching humanity and we're not smart enough to realize it, YouTube video by Close Encounters UFO.







So, here's the father of space travel Wernher Von Braun writing a book called the Mars Project and in it he names Elon as the man who is going to take mankind to Mars in reusable rockets, head a colony and introduce us to Aliens. If you're starting to disbelieve the end bit I'll quickly point you to the beginning.
















Quote:
Weirdest of all, von Braun imagined a future Martian government in which the head of state went by the title "Elon." via Reddit r/SpaceX lounge.



The original copy of the book Mars Project. Wernher Von Brauns own typed papers of the book Project Mars A Technical Tale.


How amazing is this guys!


Here is page 391 underlined in red and the word Elon in a red circle highlighted.




Here's the link to that tangible evidence of prophecy, insider knowledge, time travel? Why did Von Braun say this, how did he come into possession of the knowledge of the future? 

Source CNET.

Space Station Gets More Silver Disks Visiting

The International Space Station astronauts are so busy with the "experiments I suppose" that they can't even see a UFO outside their ISS.



I have no idea what they're doing in regards to the ISS experiments (who does) it must be more important though than the discovery of life in the universe? How is it though that we seem to get more footage of UFOs visiting the space station then we do of the astronauts fulfilling their obligated, scheduled experiments and tasks! Do you find that peculiar like I do?













Isn't that a bit weird to you, I know it is me. I think that's straight up bonkers but anyways, the unofficial story must be that the astronauts are there to welcome, greet or just offer them a cup of water at the side of the race track (type of service) or even offer a sort of repair service to the passing UFOs?




Here is a silver looking disk flying very close to the International Space Station.




Close up view of the Silver UFO filmed on NASA's own live TV.



I say that because all these UFOs seem to turn up but NASA, Mr NASA doesn't even look out of the bloody window! They are paid to go to space and search for signs of life! If they can't even see one knocking on the International Space Station door then seriously, I want my money back.





Unbelievable UFO in silver is recorded visiting the International Space Station on live TV.




UFO recorded live - image from NASA live UStream TV.


Sack the head of everything and replace it with Ufology enthusiasts because I can guarantee that every slightest sign of life, UFO passing the ISS will be looked into "in depth" and straight away. Sometimes, scratch that - everytime I see a bona-fide UFO at the ISS and NASA not even looking out the window (it's really that simple) I get so frustrated!












Then the conspiracy theory starts to make a whole lot of sense that NASA, the US Government are in cahoots with Aliens to look the other way.


As crazy as it sounds, why else would they (astronauts and the live feed specialists) not even look up from growing noodles or spaghetti trees in the ISS and at least say "did you see that or I wonder what that was"?












So, without further ado, here's the brilliant UFO video. It's a very compelling Silver Disk flying right near the ISS, then it's flying away from the ISS at a very, very high speed. Please enjoy this video I've put together:






Please like, subscribe and share - thank you.


Ancient Aliens Left Clear Evidence They Were Once Here

Proving that ancient Alien's once visited Earth is hard, but proving that ancient Alien's had an impact on ancient humans is easier.


because we have physical artefacts of very early man on display and probably still to be discover (we've found so many there's probably more to be found) and that's around the world.


We've got depictions set in stone quite literally but, like I say, proving that ancient Alien's actually came down in a craft and left in a craft is a lot harder - depending on what and who you believe?



Discovered in Abydos in Egypt is a wall carving of helicopters and submarines plus vehicles and this is real hieroglyphs.

Image is public domain


For me it's easier to prove that ancient astronauts definitely existed because we know humans existed then Alien's appear in artwork, carvings and stone statues start to appear. Then it simply starts to tail off. If we interpret that to our liking, it then looks like the "visitors" have either gone underground or departed and left Earth altogether or simply moved away to inaccessible regions of Earth or they moved to places like under the ice in Antarctica.










They may have advanced information by way of advanced technology just like we have albeit very basic i.e ground penetrating radar, X-Ray, advanced robotics that can travel anywhere in any environment... And they could also have extensive knowledge of Earths inner depths and that's where they have gone too?



Related ancient Aliens post:

Mars Mysterious Anomalies.



Think of it like a sentinel sent out to scan for life forms, it's reconnaissance and it's easier than you might think! We have AI which can learn from it's surroundings and change directives determined by new parameters set out within a given guidelines. If it's new program is withing the set out acceptable guidelines... it moves forward to it's next evaluation. If you speed all that up to real time then you have a super reconnaissance robotics "nightmare" for the enemy or in this case, new place to live and not be bothered by the locals.









Send out a fleet of these sentinel robotics in to empty space and sooner or later be it 5 years, 50 years or 500 years - "we will" get a soft reply. Like a soft whisper in the ear that all parameters and objectives have been satisfied. In other words the last piece of the puzzle being discovering signs of level 3 life has been satisfied.


Level one is signs of life i.e methane, oxygen and stuff of that nature. Level 2 is ruins, structures, empty shells and abandoned places like on our Moon. Level 3 is definite activity set out by either radio signals, energy levels and the holy grail of deliberate signs of life like entities, TV signals, planes, spaceships and space travel.


This level thing could be right, it could be wrong? My guess is as always just as good as yours. We're all entitled to wonder, we're all entitled to be curious about life. Any life, be it the future of mankind or the past. Life outside of this one and life inside this Earth...


Remember, a computer is only as good as it's programmed to be and the more information the better it is at doing it's job. Computers roles are to gather, store and input everything in such a way as to be stored, optimised, deliver as best as it can be - so that retrieval is as smooth as possible. Of course there's information there that I've not mentioned but if I mentioned every single process this would be a operating manual but it's not.


It's just to give an idea of what is capable now so that taking into account ancient Aliens and their obvious advanced technology - we can determine what they could of done, did, doing and where they might be or when they could return and the biggest thing is with regards to their appearance, their technology and how did they know these crafts would be invented all the way back in the Earth's history?









YouTube video of Seti I - Tomb in Abydos in Egypt.







The video above is by Richard Arkley.


*Description of image;

English: Pareidolia. Hieroglyphs seemingly showing modern aircraft and vehicles depicted on a riser in a temple in Abydos Egypt. Polski: Ciekawy hieroglif ze świątyni w Abydos.

I used Canva to add writing to the main desktop image. Why not check out and create a design for yourself? Canva is quite possibly the only online all-in-one media editor you'll ever need. I've used it for what 8 years now and it's always had everything I needed. That's why I'm writing this now, to say thanks.


Image by Olek95 - Own work, Public Domain via Wikimedia.

Massive Well Defined UFO Absolute Proof of Intelligent Life in Space

Seriously, there's no doubt in my own mind that Aliens exist in space for sure, because they interact with the International Space Station or ISS "regularly".



The astronauts onboard the ISS on the 20th October 2016 must of known about this craft because we have them referring to this awesome looking and somewhat Alien looking vehicle (because it can't possibly be ours - can it) on video/audio, but they don't mention it when asked, ever.












The astronauts never do, do they!




Iss-ufo-looks-alien-and-the-astronauts-must-of-known-about-it




There, I've said my piece and it's only my opinion, but would you like to know what that's based on? I'm pretty sure that you do because you wouldn't be here right now reading this, right? It's based on many years research of the ISS live feed footage of the UFOs appearing and disappearing.




More-defined-looking-ufo-iss




It's based on the process for what happens when a UFO is spotted in the live feed by the astronauts and what the mission control starts to say and the astronauts say in a very odd and sometimes off topic exchange of words.



UFO-next-to-the-iss




Believe me, I'm not the only one who's noticed the totally "mid sentence change of subject" where the astronauts and mission control (example) are talking about the process of turning a back up generator on or rerouting electricity from one capsule to another - then all of a sudden mission control will say "copy all, it's with you, thanks. Then they'll say "did you do anything that is part of the source maintenance in addition to what is being reported on". But she cut off the astronaut just after he said "it's a ship"!


Here's the link to that ISS UFO story.


It's still happening, it's been happening since the live feed was introduced and it will continue to happen. Albeit, the codes and phrases, the signals and behaviour may change but the process will not change. They will always have a code for as soon as a UFO comes into view on a live feed.












Video by Streetcap1 link below.








There's a famous clip of a UFO uncloaking right near the ISS and an astronaut is heard saying "It's a ship"! In fact I'll just pop out and get you the quote from the website which I remember reading, one minuet:


It's a ship.
 By Either Oleg Skripochka or Alexander Skvortsov.



The UFO has right angles, left angles, unusual colouring, it's got wings with a distinctive flap at the end of the extended wings. There's a center console type "bridge" or control center piece set in the very same place you'd expect a human kind Jet or plane? That's what makes this so odd and very familiar but we know it can't be.












Guys, thank you for stopping by and checking out this amazing piece of evidence. Please leave a quick comment and share the post, cheers.


Source Express.
Source Images NASA.

Apocalyptic Trumpet Sounds From Mountain in China VIDEO FOOTAGE

This loud horn or trumpet type of sound, isn't natural at all and it certainly isn't a friendly noise let's put it that way.


A few people on Twitter have said that this "smells of B.S" which I suppose is kind of research but is actually only a lazy opinion full of sarcasm and well, nothing really. It's a nothing answer which we are supposed to accept because why?












Seriously, Chinese experts are saying these sounds are made by a bird called "The Yellow Legged, Three Toe Quail"! That's about as bonkers as two left feet and two right hands. But, these are the experts and we are but the recipients of their expertise, lol.



Trumpet-sounds-emitting-from-a-mountain-in-china


Image Credit Pear Video.














Local officials had to even set up road blocks near the place because of people swarming to see what was going on, while experts was sent to investigate it.



Angels-with-7-trumpets-painting



The seven angels with seven trumpets, and the angel with a censer, from the Bamberg Apocalypse.



Super scary sound emitting from a mountain in GuiZhou, China for more than 10 days is the title of the video.
TCN Today Facebook. 



I know this isn't a UFO but it certainly qualifies as a freak event which needs to be shown to as many people as possible - just for the absolute scariness of the event. It's also possible that it goes even further than that, read on...


After listening to this for a bit I get the sense that the people literally don't know what to expect and at any moment, it looks like they don't know what's going to happen (if anything) but yet they still turned up to listen to the eerie trumpet like noises! The eerie similarities to a trumpet sound which was heard for miles in every direction is written at the bottom of the video as the "7 Trumpets" which is a reference to the John of Patmos vision of The Son of Man (Wikipedia).


After hearing these unimaginable trumpet like sounds the people look scared.


The actual video is recorded right on top of the mountain where the sounds have been going on for ten days solid - are coming from. It must be very scary to say the least as it might be the tectonic plates underneath the mountain moving which means it could literally erupt, collapse, earthquake and a hole could appear swallowing everyone whole?


Even experts from Beijing have been to do research because it's been going on for such a long time. 


NASA post link:


I know of sounds which sound similar to this have been popping up all around the Earth in different places and different sounds but they where all very loud, horn or trumpet like and sounds which get the people listening to it - to immediately start thinking of the apocalypse and then religion starts to play a part of peoples thoughts.


UFO believers and Alien entity believers probably see this as a freak event but explainable somehow and the best place to find that is right at the doorstep of the Government because somehow, they did it! Lol.





If not the Government then NASA was definitely and most likely the only culprits behind it. OK, so i'm poking fun at myself there because i'm the UFO believer and the Alien entity believer of which I just mentioned but as a logical thinker also (this it's not a contradiction) there has to be a logical answer - right?


It's just getting to that specific answer which could be anything at this point in time because it only happened on the 20th of June, 2020.


People are claiming it to be a Dragon (not even going there) and some are claiming it to be the 7 Trumpets and the apocalypse. You must understand that China has a very different world view and their views on "their own history" is very different to our very boring history. Please understand that just because something may sound to fantastic to be true or real, just remember that UFOs now exist and we've walked another planet - all of which would of had you thrown into an asylum not that long ago!


Thing's can and do change and that's a fact!












Here's the TCN Today video please enjoy:




The video in my opinion is real and because it's been extensively talked about, it's received a lot of media attention in China and the rest of the world so, I'm definitely going to say that this is legit. I mean, it's been extensively looked into and written about on Chinese social media and other countries social media and blogged about a hell of a lot. I've added just a few links at the bottom of this post for you to check out.



This is one of the most baffling events I've ever heard about.




First trumpet

Upon the sound of the first trumpet, hail and fire mingled with blood is thrown to Earth, burning up a third of the trees on the planet, and all green grass.


I'm adding a Wikipedia link so you can go and read all about the 7 Trumpet's and what they mean according to religion? But if your like me, there has to be a logical answer like I've already mentioned. I do believe it's the tectonic plates and not a Dragon or the apocalypse.


But, that's only my opinion just like your opinion mine don't count more or less than anyone's because there's no definitive answer so I will not tell you that your opinion is dumb and please, let's just have a thinking session about this and try to figure this out, cheers.


Please like and leave us a comment and your honest opinion, thank you.


Source Sonny CK Tye Twitter.
Source Daily Mail.
Source CK-12.
Source Pear Video.
Source Express.

Popular Post's

Popular Post's All time