2 UFOs Inside Unknown Pink Phenomena Recorded By RAF Officer

This is the British Armed Forces we're talking about here guys, it's a reliable UFO witness.


I can't believe what seems to be going on but unchecked in the world without any authority taking action? But on the other hand, what can they do about it anyway? Nothing is the answer and that's probably why they say nothing about UFOs, because they are powerless to do anything.







UFO National Archives consultant David Clarkes book regarding the Ufology genre. Well worth checking out.






I think that's why this brave RAF Officer (name blacked out) has gone on record without fear or intimidation by anyone as he sees it as his duty to tell his fellow mankind about Aliens watching the world. Yes, it's his duty, it's your duty and for someone else to say you don't need to know, well I'm afraid that doesn't fly with me. It doesn't sit right with me and it should not sit right with you!


What's next?


The said RAF Officer was in Sri Lanka and sent the photos to his superiors and they responded with a message that he should contact the Sri Lanka Government. I found this article on the NBC website;


One of the files documents the experiences of a retired RAF officer who said he saw a UFO while on holiday in Sri Lanka in April 2004 and sent the Ministry of Defense supporting photographs, so again here's proof that the MoD is well aware of the UFO presence and they simply lie!



My gripe is this "what else is there, that they (MoD) are lying about".


The photographer wrote to his former colleagues at RAF Fylingdales in North Yorkshire saying: “You must admit they are unusual.”



The man, whose name was blanked out in the released documents, said: “I noticed a partial aura in the sky, a minute or so later there was a clap of thunder, then a short while later a ring like a doughnut appeared – the ring was orange in colour with a white/cream finger pushed through the head of the column, glowed an orange colour, behind the doughnut was a second cloud of colour , and a further ring of orange.”


He added: “The only way I can describe the sighting is that of an atomic or *another type of nuclear explosion, the cloud from which did not rise in the sky, but headed from the high atmosphere down toward the earth.”


In its reply, the ministry suggested that the officer contact the Sri Lankan Government.


Go here for the full story on the NBC website. 




The photo above is of an unknown aircraft in the shape of a triangle, it's at a very high 〽 altitude taken by an unknown eye witness.


Below;
Photo taken by amateur photographer Jeff Templin in Kansas on April, 16 2014.



Then low and behold here's another exact copy of the same craft from 2014. Are these pictures of the TR3A Black Mantra or just a TR3B, a UFO or something else entirely like an unknown Russian advanced spacecraft. It's not always got to be American you know. The Russians are equally good with reverse engineered technology you know.



Go here to the RAF National Archives for UFOs. They have put together an impressive help guide, seriously it's impressive to see them helping out for a change.



A retired British Royal Air Force Officer has definitely gone on public record in a "right Royal fashion" and has stated that this is the UFO photograph he took.






Photo circa March 2004 of doughnut-shaped phenomenon was photographed by a retired RAF officer and sent to his old bosses tasked with investigating UFOs.


CREDIT PA



Why do I sound surprised about this spectacular UFO event, I hear you ask? Because this is not everyday that a British Royal Air Force Officer goes on public record about anything at all let alone possibly damaging UFO incidents! Because we have credible and trustworthy origins regarding this remarkable UFO event, it's as good as it's going to get. That's why I am starting to get a good impression about it.



Here's what I see;


There's what appears to be 2 UFOs, one of the "apparent UFOs" is leaving what looks like a pixelated haze in it's wake behind it. It looks silver or white, pretty much the same colour as the UFO itself. That's the one in the lower right corner by the way.



But the one near enough in the very middle of the glowing pink light (Aurora phenomena) - that one could be the one responsible for the actual "visual spectacular bonanza". I've seen UFOs spraying green gasses, liquid and also dropping things so this doesn't surprise me one bit.


With regards to the RAF doing anything (something) about the obvious UFOs running around the place like this is their own bolthole in the sun, well it's the usual story isn't it. They don't investigate UFO reports and as far as they're concerned, it's none of anyone's business!


A spokesman for the RAF said that "it had been assessed that it would be better to publish these records, rather than continue sending documents to the National Archives, and so they are looking to put them on to a dedicated gov dot uk web page".



“I'm not the voice of reason. I am the reason for the voice.”-TB


Another type of nuclear explosion... What is this other type of nuclear explosion to which this blacked out named person is referring to? After all, he is a military officer so he has clearly got intimate knowledge of certain things that the public at large knows nothing about?



Credit The Telegraph.
Source NBC News.

Reference; David Clarke, author of the UFO Files and a UFO National Archives consultant. Thank you for your time and your efforts on the UFO phenomena David. The Ufology genre is a source of inspiration to myself and the people of this planet. Your help is much appreciated and I personally would like to thank you for taking the time out to contribute a wealth of information.

43 UFO Orbs Gather In Formation Above Mountain

This is one of the most UFOs in a video that I've ever seen.









Image source Google Search/Canva/UFO Sightings Footage.


Firstly I would like to thank you for your time and say that if your common sense tells you that this isn't real then that's all good. But, like me I truly believe that this video is real and that the UFO Orbs in the video are quite genuine.












This image below shows the UFO Orbs just before they all get into formation.






Image source Google Search/Canva/UFO Sightings Footage.



Of course it could be a huge laugh at our expense and we could find that some poor unfortunate soul feels the need to poke fun at a UFO believer...



This, for me, isn't in the latter category but I do think it's healthy to keep an open mind in Ufology and understand that it might be from a movie (which I doubt) or it could be a bored student desperately trying to impress someone who doesn't even like him or her. It's sad but it happens.













Then there's the national UFO believer targeting agency (I don't think it is a real name) whereby people are tasked with putting out believable UFO videos to create doubts about Aliens and UFOs in general. But in a broader sense that if they flood social media with dubious UFO videos it will create more uncertainty around Alien disclosure and UFO disclosure.



UFO disclosure has been and gone. It pretty much went over everyone's heads and that's because it had a different name to;








These UFOs are real, they're all in formation in such numbers and therefore they can be seen from a far off distant point in space. It probably isn't anything to do with it but it's worth mentioning that potentially this UFO formation could be seen from far away in space.


There's no information with it, there's no point of reference to say where it was taken from and who's the eye witness and when it happened?




But that's okay because it exists, it's a good point of reference for researchers to say that a possible UFO encounter has taken place here?


And that's awesome!













Here's the very remarkable UFO video:









Please leave a comment on why it is real looking to you and also why you think that it might not be real? Either way, cheers for your time and effort.



Source: Google search.
Source edit: Canva. 

UFO Dives Into Mexico Volcano Caught on 24/7 Webcam

I kid you not, this is a UFO that if there was no evidence of it you'd probably think that the story is a bit far fetched.



But, it also divides a lot of people because to some it's a bit to far fetched but to so many people, "we" believe that anything is possible especially real UFOs vouched for by the Government.

Check out this amazing image taken from the webcam which monitors volcano...





Image credit webcamsdemexico.com



It's filmed in Mexico in 2012 and it's not the first one to do a direct dive into a volcano as Google has a ton of volcano slash UFO videos that show some strange goings on.


















Some have concluded that the object is either a computer-generated hoax, or a simple glitch in the video. Dr. Margarita Rosado Solis suspects the visible object in the video she was shown was not in the original video... But, that doesn't make any sense at all to me because "why would she be shown a random video without a UFO".



Here's the YouTube popocatepetl UFO video by Weird World TV.














The whole reason why she was shown it was to comment on the anomaly. See, it's a 24/7 recording so why would the fine Dr be shown a specific part of a video. What was her original reason for looking at the volcano footage? See the full story here.



Volcanoes are a raw energy system that travels right into the Earth, is this why they are attracted to the volcano do you think?

Check out this quote from Mexico News Daily;

One area with many sightings is the San Mateo corridor, where planes coming in from the north approach the international airport.

Sightings here usually describe a light or spherical object that moves off to the side as a plane approaches and returns after it has passed.









In a new video, a UFO seems to approach Mexico's Popocatepetl volcano, then slows down, turns and deliberately enters the smoldering volcano crater.

The video, recorded on May 30 at around 8:30 p.m (the below video), is the latest in a series of alleged UFO events that have taken place near the central Mexico active volcano since late 2012 (the above video).















According to International Business Times, Televisa caught the alleged UFO image on a fixed camera that is used to monitor the volcano's daily activity, located about 40 miles south of Mexico City.








I've actually written a few news articles and blog posts about this very subject which is quite real as far as I can tell. I'll add the link to at least one of the posts for you.


Source Open Minds TV

This Bizarre Letter C Was Found on a Moon Rock

Was NASA was uilising amazing model makers back in the 1930's even, and the 60's?



Like prop developers, model designers and set designers plus hobbyist's, including but not limited to architectural "scale model masterpieces" could of been created, "no problem".



Exact replicas of the Moon can and have, been created in the past - that's for sure and it is done with ease. The history and purpose of these exact replica Lunar spheres is one thing i.e reference guides and astronomy, education and for TV shows etc. But conspiracy theorists keep on coming up with one interesting idea after another that is challenging NASA to prove that they went to the Moon.






Image NASA


Let's take just one example, the C rock. I found a website that just states "if you get your facts right, it was added after the recording of the Moon landing" - and that's it? Link is at he bottom.

This is the evidence that we're supposed to believe, someone says it was added and take their word for it? Although i'm sure that this is because he or she knows something else, it would be great to show it is that makes sense? Like a before and after maybe?


But then you have this amazing and talented man (below image) with mad skills to create a to scale replica of the Moon and then it just becomes apparent that it could of been faked with ease and I mean "with ease".






Image of Roger Hayward Griffith Planetarium 1934.



Millions of photo's were taken on the Moon, millions of photos and video was taken and just because someone says it's not in the official images or video, that doesn't fill me with confidence at all.

By the way, all the Apollo missions photos and videos are missing! Only a bit has survived at all. Like a whole room full of media is missing!

In fact, it kinda tells me that it's just saying the official statement by the vested powers that be whom want to continue the charade and status quo? Astronauts in modern times get upset when people say it was faked because it's casting doubts on their fellow astronaut brothers.

But...

Look at why people cast doubts on NASA - don't hate the message, hate the lies by NASA?

Look at the evidence and that way you'll see why millions of people around the world say that NASA lies. My voice is but one, in a VAST ocean of voices.

But, each to their own and the fact is that millions of people have doubts and these doubts are based in NASA irregularities. So what, I mean "so what" if someone doesn't agree with your opinion or current knowledge? That's a good thing, it spurs me on to get answers one way or another.

The Moon, with it's surface uneven and with the rocks on the Moon coming in all shapes and sizes. So the engineers, creators and NASA back then knew that they would need exact replicas of the terrain "in the specific area" they was to be landing on because the future of telescopes, space travel is coming and will get so good, they needed a convincing set and props!

It could of been replicated very easy. Especially with the close up photos of the Moon and how it looks. This information was available to anyone at NASA wishing to replicate the surface of the Moon.



Reach for the Moon and if not, get a grabber and grab the Moon with all your cunning and deviousness of props and sets just like a Stanley Kubrick movie would be set up!

But, not all is as it all seems to be - or is it!

In the Cold War there was a lot at stake and riding on the success of the Lunar Mission and if it failed (God forbid - it apparently didn't) but if it did, did the United States Government have an ace up their sleeve as it were?

Was that ace up "the proverbial sleeve" an actual movie set all ready to go and all ready to show the public an actual choreographed hoax, instead of a real life botched attempt at travelling to the Moon?

Depends on who you ask, doesn't it?






There is a lot to focus on when writing about the Moon landing hoax. It can't be done in one blog post unless your just covering the basics instead of digging deep in to the facts and the motives plus the abilities.

The USA definitely had the abilities and the right people all on board to help the nation through a space race "they had to win" either unwittingly or knowingly they had the people for each step of every way and every process, to pull off one of the 20th centuries biggest hoaxes.

Please leave a comment.
Source NASA.
Source Data Physics.
Source Reference Miehana.
Source Reference Proofofthemoonlanding.

Diamond UFO Filmed Over Moscow From Airplane Window

The many and various airplane UFO incident's are probably one of the hardest to fake or hoax because it's easily "and I mean easily noticed".




Credit Disclosure Screen The Grimreefar YouTube.













If it's been tampered with or if it's  even had any effects applied to it, and or added in plus superimposed onto it, or even inserted into the video we can all easily detect it. Guy's, check out our Instagram page and Facebook group for excellent UFO videos and where UFO events are posted just after they have happened.


Easy detectable hoaxes are ten to the dozen I agree but I also agree that hoaxers are a canny bunch and a devious "innately dishonest bunch" of toe rags. But, there's something about this UFO video that I like. I don't believe that they've done anything with it.


t's an easy going, easy flowing UFO video without any juddering, shaking, blips, clips and transitions overlapping of the colors in the shapes.






Credit: Disclose Screen The Grimreefar YouTube.



Because I'm confident about this being real, I'm going to look into this even further to get us more information because it is awesome. This is just a blog news article to point out to you that this is possibly real and very good (might I add) UFO video so people are going to be at least up to speed with this latest UFO video. This is part of what I love to do, it's about bringing you great UFOs seen by real eye witnesses and then delivered straight to your dinner table (so-to-speak).














Without further ado, here's the video which was uploaded to YouTube by Disclose Screen The Grimreefar:








Here's another awesome UFO video which in this case is a Flying Saucer video from over Russia.


Credit: Disclose Screen The Grimreefar YouTube.

Von Braun Prophecy About Elon on Page 391 In His Own Papers

This is crazy, like major bizarre and strange combined with all the trimmings of a yellow submarine! But very satisfying and compelling.



I honestly don't know what to make of the so-called fictitious book wrote by Wernher Von Braun in the late 1940's? I say that because it almost seems like it's a tale but of reality, or as damn close to it that anyone without prior knowledge of, could ever write.















Was there an ancient but advanced civilization on Mars in the very distant past and did surviving Martians come here to Earth to seek refuge and did they pay the gate keeper (so to speak) with secret knowledge? The wonders of the ancient past would definitely fit in with this theory. So, we have to narrow it down even more, link things that could only be from an advanced civilization with links to Mars i.e this is why people are linking Pyramids on Mars with the ones here on Earth!


Is it all just one big coincidence? But remember, there's so many coincidences, lot's and lot's which in my eyes nullifies that theory.


Is Mars nothing more than a rock in space without any life ever existing there, or is Mars the stepping stone, the propagator, the place where it all began from and where all advanced knowledge spawned from? It was definitely important to Von Braun and it's extremely important to Elon whom is the name of the guy Von Braun wrote about saying that he (Elon) will take mankind to Mars in reusable rockets!


Mind blower or what.


So, I wanted solid evidence of this. I wanted to know if this is real or are the people who say it's fake or it's not true - are they correct?


Related post



OMG, it turns out that as hard as it is to believe, Von Braun was a prophet and he didn't even know it! It's all true.





Mars concept, Google Search.


So, here's the story and what a story it is.

















Wernher Von Braun wrote a book and in this book he says that a man called Elon will take mankind to Mars and while using reusable rockets, he will then become the head 
Was Von Braun in communication with Aliens or was he deciphering a signal from humans in the future sent back using speed? Apparently going so fast, things go backwards.







Alien contact and signal from the future from humans, Google search.


It's beyond coincidental because it talks of a man taking humans to Mars, a man named specifically as Elon, but also in rockets that are reusable! If that right there isn't a prime candidate for hidden, secret knowledge from the matrix then I really do not know what is?


I'm been serious here, is this time travel (not physical time travel but sending signals through time and space, dimension, energy if you like). Or is it a matter of decoding our human DNA where everything is stored and discovering a repeated mathematic equation which is the template for everything. A code for example.


One code but to get different messages, you apply a different way of decoding different codes,?


Code:


ATAAGTTAAGAGTAGTTAGTTTAG


Can we determine the evolutionary process through different methods and can we determine where we're going i.e specifically just like Wernher actually did? Is everything that will be or ever be, just a case of deciphering DNA with mathematics and has it been achieved in the future? If not, answer me this: How was he able to be very, extremely accurately in his "fictitious book" call the call Elon which is not a common name at all? There's no way on this Earth that all the accurate things said was one coincidence after another! No way on this God's Green Earth! Wernher wasn't a prophet so this must of come by other means and that, therein, lies the mystery...



Where did he get this information? Don't forget this was late 1940's so why did Von Braun get an unlimited free reign from the Nazis and then subsequently from United States? What did he know, what was he able to say because that's all he had was his words and then be able to get off scott free from one of mankinds worst atrocities which he utilized as forced labourers and he never ever, not once said sorry for!




Is it tapping into the realms of innate abilities (is that what he could do) or is it Alien interaction where they gave him (Von Braun) visions and secret knowledge to convince people with or quite literally could he see into the future and have shared the knowledge with the Nazis and then the US Government. It was a race to round up the scientists after the second world war.





Let's be honest, it was a race to Get Von Braun "only" and here's why I know that, please, if you will - can you name me the other people that the US and the UK plus Russia was trying to round up? EXACTLY!



Or was it just because he was the most technically savvy human being at that time regarding rockets and what it will take to deliver a rocket into any country was all knowledge but stored in his head?


If he gave them it on paper, they could get rid of him and his "horrific beginnings" and attribute the knowledge to someone else? So, keeping all the knowledge in his head would safe guard him and his chosen few?


Now that, while not verified or even contemplated by many isn't a fact, it definitely fits the answer perfectly as if it where a glove made for his grubby little fingers! I say grubby little hands because I do believe he has blood on his hands and for not apologizing (the least he could do) he is forever open to the harshness of peoples opinions throughout the forever time. It's the least we can do.


If Aliens know the future, that they've somehow cracked the code that is the future - it stands to reason they know the past so they would know whom to talk to, whom to implant knowledge, whom to bestow or depart the sacred knowledge to and yes, it is sacred knowledge.


It's knowledge of the future, it's knowledge only available to a God or God like entity so it must be sacred but only if you subscribe to this notion! If not then it's just a code to crack by anyone and it's open to anyone because it's a race. A race of knowledge and "the truth will set you free" but from what? This burden of reality, all the pitfalls and the worries, the strain, grief and pain of seeing your loved ones die.


Maybe, who knows, right?


If you think it sounds crazy, I agree lol. but, just read what Von Braun wrote, he wrote about Elon, about taking mankind to Mars (not Pluto, not Venus or Uranus but Mars). So, please before you start to resort to your default setting of sarcasm, dismissal, rejection and to poke fun at the crazy person writing bizarre and crazy things. Just remember what he wrote and accurately I might add and what he prophesized! Please.



  Results of what I have discovered might be way off but then again it's 50/50 because it's either correct or incorrect...



Artist's impression of SpaceX's proposed Mars Base Alpha. Credit: SpaceX.

There's just no way that Von Braun knew Elon... He died in 1977! Elon was a kid at the age of 6yrs! Von Braun wrote this book in 1948.




Von Braun.




Von Brauns book Project Mars. 


So, wtf is going on? If your wondering why Von Braun and Elon are been talked about here - it's because Von Braun prophesized that a man called Elon would take mankind to Mars and will become the Head of the colony on Mars!




This is from Von Braun'sown book which I have found, and found the original script for the book. People said this is a myth and that Elon is not even mentioned in this book but I'm here to set that record damn straight with a link to the prophecy book that is "Project Mars A Technical tale". The book first published in 1950 and subsequently in 2006, 20th October.

Check this snippet from an article I read (all links are at the bottom of the page also).


Before German-turned-American engineer Wernher von Braun was conscripted to build rockets for the Apollo project, he published a short book in German, "Das Marsprojeckt" (later translated to English). It envisioned reusable rockets!


Does it sound familiar to you? 

Reusable rockets, it's possible that we are witnessing nothing more than a coincidence? But then it gets more Simpsons than Simpsons could ever get! It gets to specific for my liking, and I do not believe in coincidences - at all, forever, full stop. No such thing.



Aliens are watching humanity and we're not smart enough to realize it, YouTube video by Close Encounters UFO.







So, here's the father of space travel Wernher Von Braun writing a book called the Mars Project and in it he names Elon as the man who is going to take mankind to Mars in reusable rockets, head a colony and introduce us to Aliens. If you're starting to disbelieve the end bit I'll quickly point you to the beginning.
















Quote:
Weirdest of all, von Braun imagined a future Martian government in which the head of state went by the title "Elon." via Reddit r/SpaceX lounge.




The original copy of the book Mars Project. Wernher Von Brauns own typed papers of the book Project Mars A Technical Tale.


How amazing is this guys!






Here's the link to that tangible evidence of prophecy, insider knowledge, time travel? Why did Von Braun say this, how did he come into possession of the knowledge of the future? 

Source CNET.

Space Station Gets More Silver Disks Visiting

The International Space Station astronauts are so busy with the "experiments I suppose" that they can't even see a UFO outside their ISS.



I have no idea what they're doing in regards to the ISS experiments (who does) it must be more important though than the discovery of life in the universe? How is it though that we seem to get more footage of UFOs visiting the space station then we do of the astronauts fulfilling their obligated, scheduled experiments and tasks! Do you find that peculiar like I do?













Isn't that a bit weird to you, I know it is me. I think that's straight up bonkers but anyways, the unofficial story must be that the astronauts are there to welcome, greet or just offer them a cup of water at the side of the race track (type of service) or even offer a sort of repair service to the passing UFOs?








Close up view of the Silver UFO filmed on NASA's own live TV.



I say that because all these UFOs seem to turn up but NASA, Mr NASA doesn't even look out of the bloody window! They are paid to go to space and search for signs of life! If they can't even see one knocking on the International Space Station door then seriously, I want my money back.









UFO recorded live - image from NASA live UStream TV.


Sack the head of everything and replace it with Ufology enthusiasts because I can guarantee that every slightest sign of life, UFO passing the ISS will be looked into "in depth" and straight away. Sometimes, scratch that - everytime I see a bona-fide UFO at the ISS and NASA not even looking out the window (it's really that simple) I get so frustrated!












Then the conspiracy theory starts to make a whole lot of sense that NASA, the US Government are in cahoots with Aliens to look the other way.


As crazy as it sounds, why else would they (astronauts and the live feed specialists) not even look up from growing noodles or spaghetti trees in the ISS and at least say "did you see that or I wonder what that was"?












So, without further ado, here's the brilliant UFO video. It's a very compelling Silver Disk flying right near the ISS, then it's flying away from the ISS at a very, very high speed. Please enjoy this video I've put together:






Please like, subscribe and share - thank you.


Ancient Aliens Left Clear Evidence They Were Once Here

Proving that ancient Alien's once visited Earth is hard, but proving that ancient Alien's had an impact on ancient humans is easier.


because we have physical artefacts of very early man on display and probably still to be discover (we've found so many there's probably more to be found) and that's around the world.


We've got depictions set in stone quite literally but, like I say, proving that ancient Alien's actually came down in a craft and left in a craft is a lot harder - depending on what and who you believe?




Image is public domain


For me it's easier to prove that ancient astronauts definitely existed because we know humans existed then Alien's appear in artwork, carvings and stone statues start to appear. Then it simply starts to tail off. If we interpret that to our liking, it then looks like the "visitors" have either gone underground or departed and left Earth altogether or simply moved away to inaccessible regions of Earth or they moved to places like under the ice in Antarctica.










They may have advanced information by way of advanced technology just like we have albeit very basic i.e ground penetrating radar, X-Ray, advanced robotics that can travel anywhere in any environment... And they could also have extensive knowledge of Earths inner depths and that's where they have gone too?



Related ancient Aliens post:

Mars Mysterious Anomalies.



Think of it like a sentinel sent out to scan for life forms, it's reconnaissance and it's easier than you might think! We have AI which can learn from it's surroundings and change directives determined by new parameters set out within a given guidelines. If it's new program is withing the set out acceptable guidelines... it moves forward to it's next evaluation. If you speed all that up to real time then you have a super reconnaissance robotics "nightmare" for the enemy or in this case, new place to live and not be bothered by the locals.









Send out a fleet of these sentinel robotics in to empty space and sooner or later be it 5 years, 50 years or 500 years - "we will" get a soft reply. Like a soft whisper in the ear that all parameters and objectives have been satisfied. In other words the last piece of the puzzle being discovering signs of level 3 life has been satisfied.


Level one is signs of life i.e methane, oxygen and stuff of that nature. Level 2 is ruins, structures, empty shells and abandoned places like on our Moon. Level 3 is definite activity set out by either radio signals, energy levels and the holy grail of deliberate signs of life like entities, TV signals, planes, spaceships and space travel.


This level thing could be right, it could be wrong? My guess is as always just as good as yours. We're all entitled to wonder, we're all entitled to be curious about life. Any life, be it the future of mankind or the past. Life outside of this one and life inside this Earth...


Remember, a computer is only as good as it's programmed to be and the more information the better it is at doing it's job. Computers roles are to gather, store and input everything in such a way as to be stored, optimised, deliver as best as it can be - so that retrieval is as smooth as possible. Of course there's information there that I've not mentioned but if I mentioned every single process this would be a operating manual but it's not.


It's just to give an idea of what is capable now so that taking into account ancient Aliens and their obvious advanced technology - we can determine what they could of done, did, doing and where they might be or when they could return and the biggest thing is with regards to their appearance, their technology and how did they know these crafts would be invented all the way back in the Earth's history?









YouTube video of Seti I - Tomb in Abydos in Egypt.







The video above is by Richard Arkley.


*Description of image;

English: Pareidolia. Hieroglyphs seemingly showing modern aircraft and vehicles depicted on a riser in a temple in Abydos Egypt. Polski: Ciekawy hieroglif ze świątyni w Abydos.

I used Canva to add writing to the main desktop image. Why not check out and create a design for yourself? Canva is quite possibly the only online all-in-one media editor you'll ever need. I've used it for what 8 years now and it's always had everything I needed. That's why I'm writing this now, to say thanks.


Image by Olek95 - Own work, Public Domain via Wikimedia.

Popular Post's

Popular Post's All time